|
Version: 2.0
Template Description: This template is for submission of gene expression data from microarrays and other DNA-based oligoarrays.This template is for submission of gene expression data from microarrays and other DNA-based oligoarrays.
Mappings for this template
Sections available in this template
| Section Name | Description | Conditions |
| Source | Information on the source of the dataset, the species it concerns and the name and version of the dataset | Mandatory
|
| Experiment | General experiment data | Mandatory
|
| Quality Assessment | Information about the quality measures used | Mandatory
|
| Conditions | Summary of experimental conditions and protocols. Use this section when only one set of protocols is applied to all samples, otherwise use Section: Protocol List. | Mandatory
|
| Expression Summary | Summary of expression profiles of genes in the experiment. | Mandatory
Multiple sheets allowed
|
| Gene List | The term "Gene" is used to refer to any nucleotide sequence whose presence can be detected by one or more reporters. This section includes information such as the type of sequence (i.e. EST or exon), the actual sequence data and any references to external genomic databases providing further information. | Optional
Multiple sheets allowed
|
| Reporters | | Optional
Multiple sheets allowed
|
| Germplasm | Information about samples used in the experiment | Mandatory
Multiple sheets allowed
|
| Institutions | List of institute codes used in passport data sections and their corresponding decoded name and addresses. | Optional
|
Source
Section Description: Information on the source of the dataset, the species it concerns and the name and version of the dataset
see section: source in GCPDataSubmissionTemplate2.0
for the following fields
institute, principalInvestigator, projectCode, projectName, emailContact, species, ploidy, datasetName, version, creationDate, remark
Experiment
Section Description: General experiment data
see section: experiment in GCPPhenotypingTemplate2.0
for the following fields
purposeOfExperiment, experimentalDesign, missingData, remark
Quality Assessment
Section Description: Information about the quality measures used
see section: qualityAssessment in GCPDataSubmissionTemplate2.0
for the following fields
qualityMeasure, standard, control, errorEstimator
Conditions
Section Description: Summary of experimental conditions and protocols. Use this section when only one set of protocols is applied to all samples, otherwise use Section: Protocol List.
| Field Name | Description | Conditions |
| Sampling Strategy | A description of the sampling strategy or reference to published method.
Example: SamplingProtocol Name="Anther sampling rice"; SamplingProtocol.Protocol Type = dissect | Mandatory
|
| Treatment Applied | A description or reference to published method of the treatment applied to a sample as part of the experiment.
Example: TreatmentProtocol Name="Drought treatment - control-well watered"; TreatmentProtocol.Description = the reference control for the experiment; TreatmentProtocol.Title = Drought treatment - well watered
Example: TreatmentProtocol Name="Drought treatment - water withdrawal"; TreatmentProtocol.Treatment type.abiotic factor.chemical type.water deficiency effect = drought; TreatmentProtocol.Description = Normal growth then subjection to water stress by withdrawing water; TreatmentProtocol.Title = Drought treatment - water withdrawal | Mandatory
|
| Sample Extraction | A description or reference to published method of how material was extracted from treated samples in preparation for labelling.
Example: ExtractionProtocol Name="Trizol RNA extraction"; ExtractionProtocol.extraction method.extraction kit manufacturer= Life Technologies Inc.; ExtractionProtocol.Title = RNA extraction from rice shoots; ExtractionProtocol.extraction method.extraction source = fresh sample; ExtractionProtocol.Protocol Type = nucleic_acid_extraction ; ExtractionProtocol.extraction method.extraction kit = Trizol ; ExtractionProtocol.Description = Total RNA was extracted from each shoot sample pool using the Trizol\u2122 (Life Technologies Inc., Gaithersburg, MD, USA) protocol | Mandatory
|
| Labelling Technique | A description or reference to published method of the steps taken to attach some form of detectable marker to an extract so that the expression levels of candidate sequences can subsequently be quantified in the scanning process.
Example: LabellingProtocol Name="Agilent direct labelling with amplification method"; LabellingProtocol.Description = This protocol first generates cDNA from total RNA by reverse transcription using the T7 promoter primer and MMLV reverse transcriptase, and then synthesizes cRNA with cy5 or cy3 dye labels incorporated directly. This method routinely results in at least a 100-fold RNA amplification and the amplification is unbiased by RNA transcript size; LabellingProtocol.Protocol Type = labeling; LabellingProtocol.Title = Agilent Low RNA Input Fluorescent Linear Amplification Kit (Product number 5184-3523) | Mandatory
|
| Hybridisation Method | A description or reference to published method of how the hybridisation was performed, including the blocking agent(s) used, the wash procedure and all relevant parameters settings of the hybridisation station.
Example: HybridisationProtocol Name="Agilent 6-screw chamber/SSC hyb protocol"; HybridisationProtocol.Title = Agilent 60-mer oligo microarray processing protocol (6-screw chamber/SSC, manual part number G4140-90010); HybridisationProtocol.Protocol Type = hybridization; HybridisationProtocol.Description = Manufacturer protocol | Mandatory
|
| Scanning Hardware | A description of hardware and/or software used to create an image by scanning the array after the hybridisation was completed. This includes all of the parameters of the scanning hardware such as laser power, voltages and gain settings.
Example: ScanningProtocol Name="Agilent dual laser microarray scanning protocol"; ScanningProtocol.Title = Agilent dual laser microarray scanning; ScanningProtocol.Hardware.Settings.1.Unit = nm; ScanningProtocol.Protocol Type = image_acquisition; ScanningProtocol.Hardware.Settings.2.Value = 633; ScanningProtocol.Hardware.Model = G2565B; ScanningProtocol.Hardware.Manufacturer = Agilent Technologies; ScanningProtocol.Hardware.Make = dual laser microarray scanner; ScanningProtocol.Hardware.Settings.2.Unit = nm; ScanningProtocol.Hardware.Name = Agilent Technologies DNA Microarray Scanner; ScanningProtocol.Hardware.Settings.1.Value = 532; ScanningProtocol.Description = Agilent dual laser microarray scanner (Agilent Technologies DNA Microarray Scanner, Model G2565B) using 532 and 633 nm laser lines) at a 10 micron resolution.; ScanningProtocol.Hardware.Settings.2.Parameter = wavelength2; ScanningProtocol.Hardware.Settings.1.Parameter = wavelength1; ScanningProtocol.Hardware.Type = array_scanner | Mandatory
|
| Image Analysis Software | A description of process by which an image is analysed to generate a series of data which can be stored in the corresponding measurement. Full details of the software used, and the parameters chosen should be provided.
Example: ImageAnalysisProtocol Name="Agilent Feature Extraction"; ImageAnalysisProtocol.Software.Manufacturer = Agilent Technologies; ImageAnalysisProtocol.Software.Name = Agilent Feature Extraction (FE) software v 8.1; ImageAnalysisProtocol.Title = Agilent Feature Extraction; ImageAnalysisProtocol.Software.Type = feature_extraction_software; ImageAnalysisProtocol.Description = Image analysis and spot quantification was done using the Agilent Feature Extraction (FE) software v 8.1; ImageAnalysisProtocol.Protocol Type = feature_extraction; ImageAnalysisProtocol.Software.Settings.Parameter = version; ImageAnalysisProtocol.Software.Settings.Value = 8.1 | Mandatory
|
| Reference | One or more references to articles in which the genotyping procedures are published. Please place each reference on a separate row in the same column. | Optional
|
Expression Summary
Section Description: Summary of expression profiles of genes in the experiment.
| Field Name | Description | Conditions |
| Gene Name | GenBank ID of the gene or locus.
Example: AK068476 | Mandatory
Unique
|
| Clone ID | Identifier of clone used as a reporter for the gene, i.e. from the KOME database.
Example: J013151O19 | Mandatory
|
| TIGR ID | ID from TIGR database. | Optional
|
| TIGR Version | Version number of TIGR release. | Optional
|
| Expression Pattern | Summary of the expression pattern observed for the gene. | Mandatory
|
| Expression Validation | Describes validation of the expression results. | Optional
|
| Germplasm ID | A unique alphanumeric value which identifies the germplasm. This global identifier links data across domains. The format proposed is concatenation of holdingInstitute:collectionName:localUniqueID. | Mandatory
|
| Is Redundant? | Flag indicating if the value represents the numerical result of a quantitative measurement or a descriptor with textual or categorical result (Y/N).
Example: Y | Optional
|
Gene List
Section Description: The term "Gene" is used to refer to any nucleotide sequence whose presence can be detected by one or more reporters. This section includes information such as the type of sequence (i.e. EST or exon), the actual sequence data and any references to external genomic databases providing further information.
| Field Name | Description | Conditions |
| Gene Name | GenBank ID of the gene or locus.
Example: AK068476 | Mandatory
Unique
|
| Gene Annotation | Functional annotation of the gene.
Example: Arabidopsis thaliana clone 11114 mRNA, complete sequence. | Mandatory
|
| Gene Sequence | The actual sequence data.
Example: GACATTTTGGTTTTTATGATCAAGAAAATTCATCTTGCATTGATCACTGTACAATGTACATTGCTTAAATGATCTCAGTGATCAGGATCAGAGGAGAAGAGAAGATGGAGTTCAAAGCAGCCATGTTCGCGGCCGCCGTCGTAGCCGTCCTCCTATCGTCGCCGTCACCGGCATTGGCTCAGAAGAAGAGCCCGCCGGCGGCGCCGTCGCCGGTGTCGCTTCCACCGAGCTTGGCTCCGGCGCCGGCGCCGGCGCCGCACTACGTCGACCTCGCCGAGCTCCTCAGCGTGGCCGGGCCGTTCCACACGTTCCTCAACTACCTGGAGAAGACGAACGTCATCGAGACGTTCCAGAGCCAGGCGAACAAGACCAAGGAGGGCGTCACCATCTTCGTCCCCAAGGACTCGGCGTTCGCCGCCATCAAGCAGTCCACCTTTTCCAACCTCACCGGCGACCAGCTCAAGACGCTGCTGCTGTACCACGCGTTCCCCAAGTTCTACTCCCTGGCCGAGTTCAAGAACCTCAGCGAGCTCAACCCGGTGAACACGTTCGCCGGCGCGCCGTACACGCTGAACCTCACCGACGACATGGGCACCATCTCCGTGCAGTCGATGTGGTCCAGGCCCAAGATCTCGAGCAGCGTGTACGCCACGAGGCCCGTGGCGGTGTACGCGCTCAACAAGGTGCTCCTGCCCATGCAGATCTTCAGCAAGGACCCGCCGGCGGCGGCAAGGCGGACTCGACGAGCGCCGCGTGCGGCGTCGGCGCCGGCGTCGTCAATGGCTTGGTGATGGCATTGGCTGGTAGCTTGATGCTCCTGTGGTGATGATCAGAGAGAGAGAGAGAGAGAGAGTTCTTGGAGTCAAATTTGCAACAGCAGCACATTGTTCATGCTTCTCC | Optional
|
| Gene Reference | References to external genomic databases providing further information.
Example: http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nuccore&id=32978494 | Mandatory
|
Reporters
Section Description: none
| Field Name | Description | Conditions |
| Reporter Name | none
Example: A_71_P122209 | Mandatory
|
| Clone ID | Identifier of clone used as a reporter for the gene, i.e. from the KOME database.
Example: J013151O19 | Mandatory
|
| Clone Sequence | Sequence of the clone.
Example: CAAGTTCTACTCCCTGGCCGAGTTCAAGAACCTCAGCGAGCTCAACCCGGTGAACACGTT | Mandatory
|
| Clone Reference | References to external genomic databases providing further information.
Example: http://cdna01.dna.affrc.go.jp/cDNA/report/KOME_J013151O19.html | Mandatory
|
| Array | The identifying string for the array, i.e. the name fo the array or a barcode.
Example: O_sativa_Agilent22K_G4138A | Optional
|
Germplasm
Section Description: Information about samples used in the experiment
Germplasm (optional)
The first field in the sample is the SampleID, which relates directly to the SampleID field in the data spreadsheet or file. This SampleID is a unique identifier of a DNA sample, which can be a sample in a well on a gel or a LIMS entry. It could even by a unique identifier developed specifically for this dataset. In the case of multiple extractions from the same material then each same would have a unique SampleID. Please refer to the section on Multiple Data Points for more details.
The GermplasmID field is an optional field for collections where a new GermplasmID is assigned each time an accession is regenerated or for some other reason a new seed or germplasm sample is taken. For this reason an accession in this case is a collection of samples with different GermplasmIDs. GermplasmID are often unique within a specific database for this reason they should be prefixed by the data name or abbreviation. For example, an entry with GermplasmID 2341 in IWIS, would be IWIS:2341.
The remaining accession data should be either in multi-crop passport descriptors (MCPD) or EURISCO descriptors format. These descriptors are MCPD defines a total of 28 descriptors for passport data, each of which equates to a column in the template. EURISCO defines an additional 6 descriptors for a total of 33 descriptors. Only a few MCPD or EURISCO descriptors are mandatory and for the sake of brevity only the mandatory and some recommended optional fields are described here. However, the mandatory descriptor provides sufficient information to allow the accession to be found in the appropriate National Inventory or genebank. For a full description of all MCPD and EURISCO descriptors please refer to the EURISCO_Descriptors.doc file, which is available fro the EPGRIS website (http://www.ecpgr.cgiar.org/epgris/) and or can be downloaded with the passport template.
see section: generalPassportData in GCPPassportTemplate2.0
for the following fields
germplasmID, localUniqueID, holdingInstitute, collectionName, genus, species
Institutions
Section Description: List of institute codes used in passport data sections and their corresponding decoded name and addresses.
see section: institutions in GCPDataSubmissionTemplate2.0
for the following fields
faoInstituteCode, organizationName, street, cityState, zipCode, country, institutionalEmail, institutionalTelephone, fax, url, primaryContactName
Copyright (c) 2004-2006 CIMMYT, CIMMYT, IRRI, IRRI
Developed by Guy Davenport (CIMMYT), Trushar Shah (CIMMYT), Ramil Mauleon (IRRI), Genevieve Aquino (IRRI)
This work is licensed under a Creative Commons Attribution-ShareAlike 2.5 License.
|
